Ez a régi-új Madrid volt!

Az utóbbi hetek meccseinek tükrében a Borussia Dortmund elleni utolsó BL mérkőzésünk üdítő kivételnek tűnik. Nem csak relatíve, egy meglehetősen tartalékos, önbizalmában megtépázott ellenfélhez mérve volt egész jó ez a meccs, hanem abszolút értékben is felfedezhetők benne reményt keltő motívumok, melyek jó esetben hosszú távon is meghatározhatják a Real teljesítményét. Érdemes néhány vonatkozást kiemelten is tárgyalni. Összefoglalunk.

Kedvenc csapatunk alaposan megleckéztetett bennünket ebben a szezonban, eddig nem nagyon lehetett egyik meccsről a másikra következtetni, bármilyen részletről legyen is szó. Talán pont a rossz értelemben vett kiszámíthatatlanság és a gólínség volt az, ami rendre visszaköszönt a bajnokikon. De a BL más kávéház. Itt valahogy sokkal jobban megvan a motiváció. Ronaldónak is.

Már a meccs elejétől kezdve érezni lehetett, hogy mentálisan nagyon jó állapotban futottak a habfehérek a gyepre. Mintha ez meglepte volna a Dortmundot – lehet azt hitték, hogy elpasszolgatunk egymással, aztán mindenki hazamegy.  Szerencsére nem ez történt.

Zidane a Fuenlabrada elleni visszavágón joggal gondolhatta, hogy a nagy csapat pihenjen, majd megoldják a „kicsik”. Akkor az látszott, hogy hiányzik valami vezérlő erő a csapatból, hogy hiányzik 1-2 tapasztaltabb játékos, akik képesek a kohéziót beletenni, akik képesek azt az irányító, motivációs löketet képviselni, ami lehet akár a gyilkos befejezés, vagy a hajszálpontos támadásba fordulás is. Ugye én vagyok az, aki rendszeresen hajtogatom, hogy hajszálon múlnak dolgok. És tényleg, ha a középpályán egy-egy passz nem hátrafelé megy, hanem helyette előre indul el, akkor kialakul a gólhelyzet, és ha Cé éppen olyan motivált, mint legutóbb májusban, akkor kaput is talál.

Szerda este Zidane egy nagyon jó példát találhatott arra, hogy milyen az, amikor a fiatalok lendülete, a padon érlelődött labdaéhsége és meccs-szomja találkozik az idősebbek tapasztalatával, irányító képességével.

Hátul azért a Ramos, Varane, Nacho hármas abszolút tapasztaltnak mondható, ami nem azt jelenti, hogy „hiba nélküli”- tudjuk – , de számos szituációban garancia lehet, hogy a mentés hatékonyan létrejön, és a build-up is gyorsabban indul, és a megfelelő emberhez érkezik a labda. Varane sajnos igencsak sérülékeny, de míg a pályán volt, nagyon fontos beavatkozások fűződtek a nevéhez. A cseréjével – Asensio jött be -, Vazquez húzódott vissza a jobboldalon, és hiába tapasztalt a Nacho-Ramos belső kettős, valahogy az lett az ember benyomása, hogy már nem volt annyira stabil a védelem. Ehhez az is hozzájárult, hogy a középpályán Asensio ezúttal kevésbé volt hatékony, és a támadások gyorsabban zúdultak rá a védelemre. Szintén a játék átalakulásához vezetett, hogy a Borussia felébredt, és rendre megtalálták Aubameyangot a kontrák indításával, utóbbi saját térfélről, vagy leshatárról indulva volt nagyon veszélyes.

Zidane minden csapatrészben hagyott olyan játékost, aki képes volt irányítani azt a csapatrészt, és minden szárnyon pihentetett valakit, aki majd friss lehet a Sevilla ellen. Hátul Marcelo töltődhetett a padon, a középpályán a Kroos-Modric duó szusszanhatott, nézve, ahogy Isco tartja a labdát (de ugye a kis görbe lábú spanyol is lejött cserébe), vagy Kovacic lendületesen beindul. Elöl pedig Benzema pihent, és Ronaldo tapasztalata volt a vezérlő motívum. CR, egy újabb rekordra tört, hogy ti. minden csoportmeccsen betalál, és ez volt az az extra motiváció, ami a játékát újra hatékonnyá, és eredményessé tette.

Ebben a formációban megvolt az egyensúly a tapasztalat és magabiztosság, valamit a lendület és meccséhség viszonyrendszerében.

Fontos volt látni, hogy Theo sokkal inkább próbálta meg laposan megjátszani társait, szemben Marcelóval, aki (a sokszor rossz) beívelgetéseket erőlteti, és a másik oldalon Lucas Vazquez is a kényszerítőket kereste, és az okosabb bepasszokat a magasan középre tett labdákkal szemben.

Hátul azt láthattuk, hogy a kontrákra építő Dortmund futóversenyre épülő megindulásai során sok párharcot nyert Theo, aki vissza tudott érni, és Nachót se tudta egyszer sem túljátszani Aubameyang ebben a formában. Ez abszolút pozitívum.

De látni kell, hogy a bekapott gólok esetében viszont mindig volt olyan helyezkedési hiba, ami felelőssé tehető a kialakult szituációért. Ezek azok, melyek javításra szorulnak.

Nagyon örülök, és a meccs egyik pozitívumának számít, hogy Lucas Vazquez lőtte a game winning gólt, a dupla tüdejű wingerünk majd 13 km-t futott a meccsen, ami magasan a legtöbb volt az egész mezőnyben. Neki ez a találat hatalmas lökést adhat, ami befolyásolhatja a következő meccseit.

ReAlantos:

Sokáig kerestem a megfelelő szót arra, hogy milyen érzésekkel, milyen hangulatban ültem le a meccs elé. Végül arra jutottam, hogy a megfáradt a leginkább illő jelző. A bajnokikon mutatott teszetoszaság, Zidane töketlensége kicsit motiválatlanná tett nem csak jó néhány padon ücsörgő sztárpalántát, hanem bizony engem is.

Mégis vártam a tegnapi mérkőzést. Miért? Mert ahogy Sultan is írta, a BL az bizony más kávéház.

Kicsit olyan érzésem van az egésszel kapcsolatban, mintha nem csak Benzema és Ronaldo motivációja korlátozódna az elitsorozat küzdelmeire,  hanem bizony Zizué is. Mert míg a bajnokikon minimumra törekedik, addig tegnap este például egész tökös kezdőt álmodott fel a gyepre. (Oké, Ceballos még ott lehetett volna, de ne legyünk telhetetlenek.)

Gyorsan megemlíteném a három negatívumot, amiből kettő nagy szívfájdalmamra két számomra igencsak kedves játékost érint.

Első: Varane sérülése. Nem tudom, mennyit kell kihagynia, de a Sevilla elleni meccs igencsak kárát láthatja ennek a történésnek.
Második: Asensio gyenge formája. Korábban is mondtuk már itt a Merengués hasábjain, hogy Asensiónak mintha kicsit fejébe szállt volna a sok dicséret, és bár enyhítő körülmény, hogy tegnap kényszerű csereként állt be, a mutatott teljesítménye így is serényen táplálhatja ezen kritikákat. Harmadik: a csapat bent maradt az öltözőben. Az első félidő végére Varane kiesésével a védelem is egy kicsit megbomlott, a kapott gól így némileg megbocsátható. Viszont az, hogy a sorokat a szünetben sem sikerült rendezni, és a fiúk a következő negyedórában szinte motiváció nélkül tengődtek a pályán, az számomra kritikus negatívum, amit a későbbiekben (érthető módon) nem szeretnék viszontlátni.

Szerencsére azonban sokkal több a pozitívum a tegnapi meccsel kapcsolatban. Egyrészt, mint már említettem, a szezon során talán először végre egy tökös kezdő volt a pályán. És mintha a szerepét is tudta volna a legtöbb ember, manapság ez is ritka.

Másrészt, ki kell emelni, hogy mennyire jól teljesítettek a perememberek. Jó látni, hogy ennyi fenékrepesztő padozás után ennyi motiváció van bennük, és legtöbbjüktől még a teljesítmény is az első csapat optimális szintjéhez mérhető (ugye talán kizárólag a fentebb már említett Asensio a kivétel).
Harmadrészt, a csapat az említett szünet utáni rövidzárlat, és az újabb bekapott gól után képes volt egy sebességi fokozattal feljebb kapcsolni, és most egy kicsit Fortuna is újra mellénk szegődött Lukács góljánál. Egy majdnem eltékozolt győzelmet hozott vissza Ramos-time közelében a habfehér alakulat, és ez még akár fordulópontot is jelenthet.

Részemről ennyi, és ez alapján talán egy kicsit derűlátóbb hangulatban ülök neki a Sevilla elleni meccs beharangjának. Hala Madrid!

Visszavéve egy bekezdés erejéig a szót ReAlantostól, van halvány remény arra, hogy a Madrid régi küzdőszellemét láthatjuk majd a Sevilla ellen is, csak némileg új játékosokkal. Azért senkinek ne legyen kétsége, a most pihenő Marcelo, Kroos, Modric és Benzema biztosan kezdeni fog.

Oszd meg a posztot, ha tetszett!

  • majk

    persze nem rossz az ÖF se, de azmi igazán fontos:

    Az Aranylabda-szavazás 25. helyezettje: Karim BENZEMA!

    • sultan2004

      Simán verte Coutinhót! ,-) Így van ez rendjén!
      Már az is vicc kategória, hogy a jelöltek közé kerülhetett. Mint ahogy az egész Balon D’or szavazás egy vicc.

      • Na igen, ennyi erővel Nikolicsnak is Benya előtt kellett volna végeznie… Az Aranylabda is olyan lett, mint az Oscar: nem az nyeri aki tényleg megérdemelné, hanem akinek jobb a marketingje.

        • majk

          ja Karimnak elég jó a marketingje a pornóvideóival meg zsarolási botrányaival

      • johnglade

        Szerintem azért örüljünk amíg két ekkora legendát láthatunk ezért egymás ellen küzdeni. (Természetesen Benzemára és Coutinho-ra gondolok.)

      • Ronrics

        az a baj, hogy a mostani cécó – tán ez a legjobb kifejezés rá – hitelteleníti a korábbi e témában történteket is.
        Coutinho és Benzema ég és föld!
        Az könnyedség ahogy a brazil játszik, az igen!

        • elkesetthusvetinyul

          …ha nem fáj a háta…

      • Gareth

        Igaz is, őt kellene leigazolni nyáron.

  • Csáti László Károly

    Gratulálok Ronaldo aranylabdájához. Megérdemelt.
    Nem károgásképpen, de én még várok azzal, hogy elindultok-e fölfelé. Lássuk mi lesz hétvégén a Sevilla ellen. Az a győzelem, és esetleg az el Classico megnyerése sokat lendíthetne, most úgy érzem kifejezetten pech, hogy közbe klub világbajnokság lesz. Mint púp a Madrid hátára.

    • sultan2004

      Legalább idén nem Japánban lesz.

      • Csáti László Károly

        Nem tolnék az európai sztárjátékosokkal, akár Real Madridról akár a Manchester Unitedről lenne szó, de más szempontból fájdalmasnak tartom, hogy az araboknál rendezik.

      • elkesetthusvetinyul

        hol lesz?

        • WT14

          UAE.

          • elkesetthusvetinyul

            egyik jobb, mint a másik 😀

  • helybeli

    Szabad szólni? 🙂
    Szerintetek Cristiano Ronaldo a Real Madrid legjobb játékosa?

    (ha az oldal adminjai a kérdésem támadásnak értékelik, azonnal törlöm, és elnézést kérek)

    • Cornelius Scipio Africanus

      Guti a legjobb játékos. Csak kár hogy már nem focizik 🙁

      • helybeli

        Guti remek játékos volt.
        Igazából a kérdésem a jelenlegi keretre vonatkozott …:)

        • Cornelius Scipio Africanus

          Szerintem a legjobb játékos a Real Madrid. A csapat. Legalábbis én ezt szeretném. Én Gutit tudtam romantikusan nézni. Aztán felnőttem, és sokkal komplexebben nézem a focit. Nem érdekel egy játékos se. Pár év aztán nem lehet nem is itt lesz. Én meg Real Madridnak szurkolok, nem a játékosok sikerének. Ez egy csapatsport. Persze jó ha valaki tud egy világszintű extrát letenni. Én nem akarok ilyen – számomra! “buta” – játékban részt venni, mert nálam:
          CSAPAT > bármelyik játékos, edző, elnök.
          Én a Realnak szorítok, nem játékosoknak. Én a csapatért, a játékért ülök le meccset nézni, nem egy játékosért.

          Remélem megmagyaráztam a fenti válaszom.

          • helybeli

            Igen, teljesen megmagyaráztad, és köszönöm.
            Ezt a részét pedig kb. pont ugyanúgy látjuk.

    • Ronrics

      én nagy Cr fan voltam-vagyok, de már rég nem az

    • Gareth

      Felesleges a kérdés és provokáló. Tudjuk, hogy Karim klasszisokkal jobb, csak neki ki kell szolgálnia C-t.

      • helybeli

        Köszönöm a választ.
        (Talán nem hiszed el, de nincs szándékomban provokálni. Elég régóta vagyok a blog olvasója, és úgy emlékszem, már jó ideje erős kritika van itt Ronaldoval kapcsolatban. Erre ma kiderült, hogy őt választották 2017 legjobbjának. Arra voltam kíváncsi, hogy ti ezt hogy látjátok.
        Ugyanakkor azt is tudom, a kérdést nehéz nem fricskának, provokálónak, trollkodásnak tekinteni, szóval jogos a felvetésed.)

        • Cornelius Scipio Africanus

          Szerintem a többség itt leszarja az aranylabdát, ezt őszintén mondom. Látsz itt egy örömködő vagy aranylabdát váró üzenetet? Nah, nem véletlen nem 😀

          • helybeli

            Valóban, talán egy valaki írta, hogy megérdemelte (és ez késztetett arra, hogy feltegyem a kérdést). A nagy többség meg az egészet egy cirkusznak tartja. Megint egy véleményen vagyunk.

          • Krityó

            Mondjuk én örülök, hogy ő kapta és nem Messi vagy Neymar. Hogy megérdemelte-e? Szerintem meg, így a lelki békém rendben van. 😀

          • helybeli

            Ezért vagyunk szurkolók és nem szakértők.

          • Krityó

            Ez pontosan így van. Ha értenék hozzá, Sultan va RealRaul Josénak hívnának. :DD

          • elkesetthusvetinyul

            szóval az egész a te hibád? 😀

          • Krityó

            Hát persze… Minden. 😀

          • andreal

            Csak a tisztánlátás kedvéért: ő Barca drukker.

          • helybeli

            Így van, de szerintem ez nem is volt kétséges senki számára.

          • Manócska

            Aranylabdát váró üzenetet ugyan nem írtam, meg nem is örömködtem, de ennek ellenére én azért örülök annak hogy a 3 végső jelölt közül ő kapta.

        • Gareth

          Ezert is adtam komolytalan kerdesre komolytalan valaszt.

    • kodex

      A “legjobb” szubjektív fogalom ilyeneket kérdezni kb. olyan, mint Aranylabda díjakat kiírni akkor, amikor totál lehetetlen objektív körülmények között összehasonlítani 1 kapus – védő – középpályás – csatár teljesítményét még 1 mérkőzésen is, nem hogy teljes szezonban. (Arról nem is beszélve a mai fociban sokszor a szerepköröket még azok sem értik/értékelik igazán, akik elvileg szakértők.) A foci csapatsport – ezért (is) lehet pontszámgyűjtéssel, és/vagy kiesési rendszerrel bajnokságokban eldönteni 1 elsőséget, nem pedig ún. “szavazással” vagy időméréssel. Vonatkozik ez Messi – Iniesta párhuzamra (anno) és CR7-akárkire akár idén. De ezt itt is, számtalan postban és máshol is, a józanabbak elég világosan levezették már (nálam jobban és bővebben).

      • elkesetthusvetinyul

        vannak dolgok, amik egyértelműek. a “kodex kedvenc nyula “-díjat a szakértő zsűri egyhangú döntése alapján idén is én nyertem 😉

        • helybeli

          Bunda.
          Sőt, nyúlbunda.

    • WT14

      Összességében, játéktudásban igen, ezt nehéz lenne vitatni. Ahogy lejjebb Cornelius leírta, a Real Madrid a legjobb játékos, viszont ha a tavaszt nézzük, amikor a kupákat osztották, szvsz CR az egyetlen játékos, akit ha kivettünk volna az egyenletből, akkor nem nyert volna két nagy trófeát a csapat, de lehet hogy egyet sem.

      • helybeli

        Köszönöm.
        Bocsi, (nem igazi) provokáció ON: akkor 2 hónap, vagyis inkább 3-4 meccs alapján lehet azt mondani, hogy megérdemelte.
        Ronaldo fontos gólokat lőtt, nem vitás. De nem egyéni akciókból, hanem a csapat teremtett gólhelyzetekből. Ahogy mondjátok, a csapat nyerte meg a BL-t. 3-4 játékos precíz, tényleg komoly munkáját learatta Ronaldo, mert jókor érkezett.
        Megkaptam a válaszokat, nem “provokálok” tovább. És tényleg kösz a korrekt válaszokért.

        • MrPaul

          Nekem még egy kis meglátásom van. Kicsit ez a csak ott van és belövi a helyzetet, ami mások munkája gyümölcse kezd elmenni abba az irányba, mintha az egyszerű befejező csatárság annyira ördögtől való dolog lenne. Nyilván nem jobb, mint Messi, de szerintem jogtalanul degradálják le őt sokan ennyire, csak azért, mert már nem cselez úgy , mint régen. Nistelrooy is hatalmas játékos volt, pedig ő aztán tényleg bója volt, az már más kérdés, hogy persze nem is nyert Aranylabdát.
          Nem Cr Aranylasztiját akarom védeni, csak úgy érzem, kicsit indokolatlanul lenézitek őt, hogy már “csak” a meccsenkénti egyes gólátlagot teszi hozzá a csapathoz.

          • helybeli

            CR még mindig a top csatárok között van, ez nem kétséges – hülyeség lenne mást gondolni, hisz bizonyítja. Most az Aranylabda miatt szóltam csak (egyébként nem a vita kedvéért), mert hiszen tavaly még a legjobb góllövő sem volt. Minden más összehasonlításban pedig nem hogy Messi, még jó páran megelőzik őt más csatárok is pl. csel, passz, gólhelyzet, stb. paraméterek tekintetében.
            CR nem sokkal jobb befejező, mint Dost, Lewandowski, Cavani, Aubameyang, Kane, hogy csak párat említsek (ha egyáltalán jobb, hiszen ők meg is előzték tavaly) . A különbség, hogy CR BL-t nyert, viszont – ahogy többen írtátok – azt meg a csapat nyerte. Más szóval: ha Kane játszott volna mondjuk CR helyén tavaly, akkor most ő lenne az Aranylabdás? Nem CR képességei miatt nyert ő, hanem mert a csapata, amelyben játszott, nagy trófeákat nyert.
            S persze az én elfogult Barcás énem meg azt mondja: Messi 2017-ben minden mérhető egyéni paraméterben a legjobb volt, tehát nem egy-kettőben, hanem mindben – csak éppen nem adtak meg egy-két gólt a bírók, így ő nem nyert bajnoki címet, és volt két meccse a csapatának, ahol nagyon gyengék voltak, így kiestek a BL-ből.
            A poén az, hogy én “telesírom a párnám” emiatt, Messi pedig tojik rá. 🙂
            Elnézést, hosszú voltam, és igazából feleslegesen is beszéltem. Kösz, hogy elmondhattam úgy, hogy nem küldtetek el a francba.

  • Ronci egy rekordot még nem döntött meg: nem ő a legidősebb játékos, aki Aranylabdát nyert. Ezt még mindig Sir Stanley Matthews tartja az elsőnél, 41 évesen. Ha tényleg 40+ éves koráig akar aktívan játszani, még ez is összejöhet neki. 🙂

    • elkesetthusvetinyul

      addig írja alá a szerződéshosszabbítást? 😉

  • Krityó

    Akkor most kellene abbahagyni az aranylabdásdit: 5-5 a két állatnak, mindenki egyformán boldog mindkét csapatnál, egyenlőség, örök élet, ingyen kóla.
    Mennyire megkönnyítené az életünket, nem, ha így lenne?

    • Cornelius Scipio Africanus

      Ha Te határozod meg az ingyen kólát, akkor az bezony Pepsi lesz 😀
      Az örök élet meddig szól? Csak hogy tudjam 😀

      • Krityó

        Az lesz, naná, rendes kólát a népnek. 😀
        Örök élet? Szerintem, amíg meg nem halunk, addig tart majd. Aztán lehet, hogy nem, előbb véget ér… :D!

        • Cornelius Scipio Africanus

          Áh nem érted Te ezt. 😀 Rossz politikus lesz belőled így. Meg kell ígérni mindent. Mindent is.
          Így felmerült bennem hogy örök élet = + 1 óra 😀

          • Krityó

            Na, ebben igazad van. Rossz politikus vagyok, emellett rossz üzletember. Csak a házassággal volt szerencsém, de az elégnek tűnik! :DD

          • Cornelius Scipio Africanus

            Többet is ér az :)))

          • Krityó

            Már várom, hogy erről a témáról saját kézből írj valamit… Jó buli lesz! :p

          • Cornelius Scipio Africanus

            Az nem hiszem, hogy mostanában lesz 🙂 Addig még sok víz lefolyik a Dunán (kiszámolhatod ha szeretnéd, ha jól emlékszem a Duna átlagos vízhozama Budapesténél 2350 m3/s – most megyek és leellenőrzöm, hogy jól tudtam-e 😀 )

          • Cornelius Scipio Africanus

            Jól emlékeztem 😀
            https://hu.wikipedia.org/wiki/Duna

          • Krityó

            Ja, persze, így könnyű… Ez olyan, mintha én most azt állítom, fejből mondom az afrikai sertéspestis vírus ORF-szakaszának nukleotidsorrendjét: GGAAAACCTTTAAAGGTTTCC :DDDDD! (Nem, nem, nem fejből, ne is keresd! :DD) Aztán linkelek egyet :D!

          • Cornelius Scipio Africanus

            Én tényleg fejből írtam 🙂 Azért ez csak egy szám, amivel én már számoltam itt pár hónapja. Így megmaradt 🙂

          • Krityó

            Hidd el, elhittem elsőre is, annyi “hülye” :DD van a földön (magamat is beleértve)! :DD

          • Cornelius Scipio Africanus

            De a tiedből egy szót sem értettem 😀

          • Krityó

            Én sem. 😀 Blöff a 20 %-a. :DDDDD

          • Cornelius Scipio Africanus

            Lehet még sem lennél rossz politikus :DDDD

          • Krityó

            Mert egyből bevallottam, ugye? Ez olyan politikusos? 😀

          • Krityó

            Megvárom, itt leszek.

    • elkesetthusvetinyul

      ingyen kóla? hol lehet rád szavazni? :))

      • Cornelius Scipio Africanus

        Nyuszik nem a répalét szeretik?

        • elkesetthusvetinyul

          valami kell hogy ártson 🙂

      • Krityó

        A fészbúkon nem, a jövő évi választáson nem. Nehezen megközelíthető vagyok… :D! De köszi a bizalmat… :D!

    • ofrnkie

      de az ingyen kóla cukros legyen ám, ne glükóz-fruktóz szöpös!4!!

  • Krityó

    Amúgy jó az összefoglaló, teljesen egyetértek veletek. Láttam a meccset tegnap, de olyan fáradtan bambultam a tévét, hogy eszembe sem jutott (!!!) bekapcsolni a laptopot, hogy kommentáljam az egyébként jó meccset. Csak ma esett le a tantusz, hogy el kell olvasnom benneteket is… Durva ez az öregedés! :DDDD

  • ReAlantos
    • elkesetthusvetinyul

      ez most valami vicc vagy csak a hatalom fitogtatása?

      • ReAlantos

        Mindkettő? 😀

        • elkesetthusvetinyul

          Vágó úr, felezzük meg :))

          • ReAlantos

            Kedves Nyúl, megjelöli?

          • elkesetthusvetinyul

            Nem, nem fogom körbepisilni 😀 😀 😀

          • Krityó

            Nyuszi, az nem az az állat. Te körbebogyózod, nem körbepisiled. :DD

          • ReAlantos

            BUMM! És így lett a Nesquik.

          • elkesetthusvetinyul

            jogos a felvetés doktor úr :)))

          • Krityó

            Teljesen nem ide vág a téma, de januártól nyúlszakértővé avanzsálok. Csak mondom. Komolyan. Nem úgy, mint fociszakértővé. 😀

          • elkesetthusvetinyul

            kezdhetek aggódni? :))

          • Krityó

            Nem kell, te élsz még. 😀

    • WT14

      Akkor itt finom utalást tennék a kedves döntéshozók nőági felmenőinek morálisan ingoványos mesterségére.

    • kodex

      1szerű: Perez idén tuti vmi nagyágyút (esetleg többet) akar hozni, mert idén csak az nem basztat minket aki nem akar. Erre jegeli a lóvét az öreg, tuti. Játékvezető/szövetség/ügyész most mellékes. amúgy: elmennek a p*ba. A szabályok azért vannak, hogy betartsuk de azért is, hogy éljünk velük. Kb. úgy mint a tétlen lessel. úgyhogy amúgy Jose stílusban:https://media0.giphy.com/media/iqEeC6iCoWoKc/giphy.gif

    • nad

      Teljesen jogos, sőt. Fel kellene szólítani, hogy a következő meccsen ahol játszik, rugjon le valakit sérülésveszélyesen, hogy kapjon 1 sárgát jogosan. Ennek így kell történnie.

  • Sragi
    • ReAlantos

      Nem Kanté 8. helyével van a probléma, szerintem tett azért ő eleget az elmúlt évben.
      Kroos 17. helye viszont vicc.

      • Sragi

        Ja amúgy Kanté god módban tolja 3 éve.
        Kroos szinten.

  • mfc777

    köszi a posztot, jól volt összevágva
    kurvára nem érdekel az aranylabda
    jó éjt mindenkinek!

  • elkesetthusvetinyul
    • WT14

      De jó is lesz, már számolom a napokat 😀 TÜTTÜRÜRÜRŰŰŰŰ TŰRÜRŰRŰŰŰ TÜRÜRÜRŰŰŰRŰŰŰ

  • nasty
  • Jose

    No… A családban egyel több férfi szurkol mostantól a Real Madridnak. 😉

    • WT14

      Na! Mindig jó dolog, ha a csapat recensen mutatott parádás játékának hatására megtér egy családtag. Biztosan látta, hogy hétről hétre milyen kitörő lelkesedéssel és ujjongással nézted a meccseinket, és őt is elragadta a szenvedély.

      Vagy, új családtag érkezett, aki természetesen genetikailag kódolva, előre determináltan RM-szurkoló, ez esetben gratula!

      • Jose

        Ez esetben. 😉☺

    • V.I.C.

      Gratulálok! 🙂

      • Jose

        Köszönöm és egyel tobb helyet kerünk a Tüskébe…

        • ofrnkie

          100% esélynövekedés a tombola-fődíj elnyerésére

          • Jose

            Ott lehet, de ha a pena kvízversenyén indulok, az nem fair. A többiekre nézve.

        • elkesetthusvetinyul

          belehúztok, és pár év múlva az Aréna sem lesz elég 😉

          • V.I.C.

            Aztán eladjuk CR-t és elég lesz a nagyanyám konyhája is. 😀

          • Jose

            Ahol a spór van?

          • V.I.C.

            Naná, még tüzelni se kell magunkat! A ház mellett meg van templom is, ha Benzema viszont velünk marad még jól jöhet gyónni vagy imádkozni.

          • elkesetthusvetinyul

            Vic, téged beengednek a templomba?? o.O

          • V.I.C.

            Naná. Minden szarul sikerült XXI. századi igazolásunk távozása után keresztet vetettem, és szépen nő az ültetvény, abból látom el azóta az épülő/felújított templomokat. #keresztkartel

          • elkesetthusvetinyul

            a jómúltkor említetted hogy ha hasonló feltételeket biztosítanának, akkor te is üldögélnél szívesen a Madrid kispadján. a tervem az hogy ha a keretben leszel, veszek magamnak VIC-mezt, amit dedikáltatok veled. kezdhetek már gyűjtögetni? 🙂

          • V.I.C.

            Egyelőre bürokratikus akadályokba ütköztem. :/ Nincs meg a kontakt még a fészbukos emberhez aki kékpipát szerez, bár Mága Zolival már egyeztettem, hogy kéne párszázezer bangladeshi lájkoló instant. A másik, hogy mindenben (és mindenben is) jó vagyok a pályán, de nem tudok szarul beadni, szóval nemsoká megyek le a közeli parkba, megcélzok egy kukát harminc méterről, és ha végre sikerül kitörnöm egy emeleti ablakot egy kísérlettel, akkor bátran útnak indulok a Valdebebas felé. 😉

          • elkesetthusvetinyul

            úgy érzem, hogy akkor divatmadridista leszek 😀

          • elkesetthusvetinyul

            na akkor oda majd én is megyek ha meghívtok 😀

    • Cornelius Scipio Africanus

      Grat José! :))

      • Jose

        Köszi, alpaka farmer! 😃

    • Ronrics

      akkor 2 kopasz van a családban …?/bocs/
      Nagy grat.!

      • Jose

        Nem, hajjal erkezett. ☺
        Technikailag en se vagyok kojak, csak kenyelmesebb a minimal hair.

    • ZeRo

      Én valahogy mindig is egy +egy nővel képzeltem az édes hármast de te tudod. 😀
      .
      .
      .
      .
      .
      .
      .
      .
      csak vicc, GRATULÁLOK! 🙂

      • Jose

        +1 kecske….
        .
        .
        .
        .
        Köszönöm! 😀

    • Csáti László Károly

      Gratulálok. Mi lesz a keresztneve: András vagy Lionell, ?????

      • elkesetthusvetinyul

        hát Zsozé 🙂

      • Jose

        Csongor 🙂

    • Sragi

      Gratulálok és jó egészséget!! 🙂

    • t20-puerto del sol

      Wowow! Grat

    • Krityó

      Mé nem mondtad eddig? Mé titkoltad? És honnan tudod, hogy Real-szurkoló lesz? Manapság már a neme sem biztos egy újszülöttnek, nem a szurkolói identitása! :DDDDDDDDDD
      Gratulálok, jól nyomjátok ezt a gyerekesdit! Sok-sok alvást és örömöt mindannyiótoknak, ez szép karácsony lesz!!!!!

  • V.I.C.

    Vallejónak lett hivatalos FB-oldala (https://facebook.com/JesusVallejo1997/), elkezdett rágyúrni a kerettagságra. 🙂

  • Manócska

    Azért az vicces, bár szerintem inkább szomorú, ahogyan más oldalakon írnak Ronaldoról. Egyszerűen már nem tudok szó nélkül elmenni mellette. Részletesen kifejtik hogy a pályán semmihez sem ért, és hogy aki szerint ő egy jó játékos, az inkább ne nézzen többet futball meccset, mert egyáltalán nem ért a focihoz. Ezt nem igazán tudom elfogadni. Szerintem korunk egyik legjobb focistája, bár tudom hogy ez nem sokat számít, hiszen én nem nagyon értek a focihoz. Viszont nagyon sok igazi szakember is ezt állítja róla, (Ferguson, Ancelotti, Santos, stb..) akik azért egy “kicsit” jobban értenek ehhez a szép sporthoz, mint sokan mások. Akkor valamit mégiscsak jól csinálhat ez az ember a pályán. Arról már nem is beszélve, hogy a nevéhez fűződő nem kevés rekord is ezt igazolja. Vele kapcsolatban pont olyan igazságtalanok a focit szerető emberek, mint pl. Murray-vel szemben a teniszrajongók. Mindehhez amit most leírtam, már csak egy gondolatot fűznék hozzá. Ha mindenki csak fele akkora odaadással és szorgalmmal végezné a saját munkáját, mint ahogyan ő teszi a dolgát a foci terén az egész pályafutása során, akkor szerintem egy jobb irányba haladna ez a világ.

    • WT14

      CR statjai a 2017-es naptári évben: 49 gól, 13 assziszt 56 meccsen (kub+válogatott). Aki erre azt mondja, hogy nem jó játékos, meg hogy a pályán semmihez nem ért, annak a véleményére annyit sem érdemes adni, mint egy csimpánzéra. A régi, nagy aranylabdások ennél sokkal gyengébb mutatókra is megkapták csatárposzton is, Ronaldónak pedig ez még egy gyengébb éve volt.
      Azok számára pedig, akik a számokkal szeretnek érvelni, itt vannak Messi statjai: 52 gól és 14 assziszt 61 meccsen. Számomra a kettő teljesítmény nagyon hasonlónak tűnik. De tudjuk, CR csak a csapatnak köszönheti a góljait, míg Messi minden gólja előtt kicselez 3 embert és bebassza 30-ról.
      Kár ebbe jobban belemenni,

      • ofrnkie

        szerintem az általad említett statokon kívül érdemes megemlíteni a “chances created”-et, ami Ronaldonál 55, Messinél 121.
        De CR és Messi is elég durva statokkal rendelkeznek sikeresség tekintetében.

        • Cornelius Scipio Africanus

          Erről mindig az jut eszembe, hogy mikor cr-nek volt több gólja, akkor a gólpassz számított, majd mikor abban is beérte (nem tudom melyik évben volt), akkor már cselezés, meg a helyzetkialakítás számított. Mindig kell valami, kell okot keresni, hogy megerősítsék azt, hogy az ő idoljuk a legjobb.
          (Ez természetesen nem igaz minden Barcásra! Nem őket akarom támadni! )

          • ofrnkie

            ebben igazad van, de szerintem attól érdemes megemlíteni ezt a statisztikát, mert valamennyire kanadai táblázat mögé néz és értékeli a pályán nyújtott teljesítményt

          • Cornelius Scipio Africanus

            Őszinte leszek. Engem kezdetektől fogva hidegen hagy az ő csatázásuk. Én mindkettőt tisztelem. És nem érdekel a statisztikájuk, vagy hogy egymással hasonlítsam össze őket. Engem az érdekel, hogy nyerjen a csapat. De értem miért írtad ezt, és jogos is, és érdekes is annak, aki ezzel foglalkozik, hogy a két játékost összehasonlítsa. Viszont szerintem ez még mindig szubjektív lesz. Ez nem tudomány.

      • Ronrics

        volt időszak mikor kb azonos kvalítású vagy értékű volt Cr és Messi.
        Azt az azonosságot azonban Messi meghaladta, bárhogy kedveljük is Cr-t-ezt el kell ismerni.
        /a kisember komplexebb focista/

      • t20-puerto del sol

        Ne bántsd a csimpiket!

    • Cornelius Scipio Africanus

      “Ha mindenki csak fele akkora odaadással és szorgalmmal végezné a saját munkáját, mint ahogyan ő teszi a dolgát a foci terén az egész pályafutása során, akkor szerintem egy jobb irányba haladna ez a világ.”
      Ezt már én is leírtam, és ebben biztos vagyok.

      Attól, hogy egy elfogult társaság mit gondol valamiről, attól még nem lesz az igaz. Bármennyire is szeretnék. Ez teljesen független Ronaldotól. Bele lehet dugni a fejünket a homokba, létre lehet hozni egy kis burkot, saját kis törvényekkel, de a világ törvényei mindig ezek felett állnak, és mindig erősebbek mint a kis burkokban lévő.

      Szóval próbáld elengedni ezt, mert megváltozni nem fog ez, és megváltoztatni sem nagyon lehet. Inkább szerintem foglalkozzon az ember azzal, ami őt előre viszi (szerintem CR is pont leszarja a rinyálásokat és inkább tovább edz) élvezze azt amit szeret. a hülyéket, rinyálókat meg ki kell zárni.
      (Persze ez nem jelenti azt, hogy nem kell elfogadni/meghallgatni a kritikát, csak nem mindegy ki mondja, és hogy. Sőt, nagyon fontosak a fejlődés szempontjából.)

      • ofrnkie

        nekem is ez a rész ragadta meg a figyelmem. én pl. sajnos nem tudom akaraterőben hozni CR szintjét az életemben, tehát ilyen szempontból kifejezetten példaértékű, amit csinál.

      • Manócska

        Valószínűleg igazad van abban, hogy engedjem el ezt a dolgot, de egyszerűen nem tudom, és valahol nem is akarom. Nap mint nap becsmérlő írásokat olvasok róla, amik szerintem egy kicsit sem fedik a valóságot. Lassan úgy lesz beállítva focistaként és magánemberként is egyaránt, mintha ha a világ egyik legrosszabb embere lenne. Pedig ez egyáltalán nem igaz! Azzal is tisztában vagyok, hogy nem tudom megváltoztatni senkinek sem az álláspontját, de nekem ezt akkor is le kellett írnom, mert az igazsághoz ez is hozzá tartozik. Különben is nehezen viselem az igazságtalanságot, mindig szót emeltem/emelek ellene, még sokszor akkor is ha tudván tudtam/tudom hogy hátrányom fog belőle származni.

        • Cornelius Scipio Africanus

          Én megértelek. 🙂 Az igazságtalanság ellen fel is kell szólalni, ez nagyon helyes. Írd is le, azzal sincs baj 🙂 Viszont ha 6x nekifutsz a falnak és 6x a te fejed fájdul meg, akkor nagy valószínűséggel ha nekifutsz hetedszer is, akkor is csak a fejed fájdul meg, a fal állva marad. Remélem érted a hasonlatom. 🙂 Én csak neked akarok jót, és megértem azt is, hogy miért bánt ez.

          • Manócska

            Persze hogy értem a hasonlatodat. A válaszom csak annyi rá, hogy elég sokszor fáj a fejem. 🙂

    • V.I.C.

      Magával az Aranylabda intézményével van a gond inkább, jelesül, hogy nem sok értelme van. De a show, a lájkgyár részévé vált, ahogy az ezeket kísérő kommentek is. És nem az Aranylabda értékelődött le, mert soha nem is volt olyan kiugróan magas értéke (legalábbis szerintem), csak a világ digitalizálódása és a sztárpáros felbukkanása helyezte egy jóval komolytalanabb polcra a társadalom szemében. Miközben mindenki ködfátyolos tekintettel réved a preCRvsMessi időkre, ugyanolyan bullshit volt 10 éve, 20 éve, 50 éve is. Puskást is pl. ’60-ban az Eurovíziós Dalfesztiválokra jellemző political voting/block voting taszította a második helyre. Nincsenek mérőszámok, nincsen mögötte ráció. Manapság annyi a különbség, hogy olyan irányba tudták tolni a modern technológiával, meg a két szembeállítható sztáralkattal, hogy ebből egy szekér pénzt ki tudjanak szedni minden évben. Ez a lényeg. A pénz, elsősorban, aztán a social activity.

    • Matdroid

      Barcásként olvasom, de nem írok ide. Most kivételt teszek, mert C aranylabdája személy szerint nekem egyre dühítőbb. Érveim:
      1.) Azt még aláírom, hogy az elmúlt 5 évben amikto 4x megkapta egyik évben sem volt érdemtelen. De ez az 5-ből 4-szer arány Messivel szemben erős túlzás!
      2.) Jól hanzik az idei BL, meg bajnoki cím, de ebben Modricnak, Casemironak vagy Kroosnak szerintem sokkal több szerepe van. A real nem a BBC miatt volt nagy tavasszal (és azelőtt), hanem a középpályája miatt. Ezzel szemben Messi ha esik, ha fúj a hátán viszi a csapatot. Irányít, támad, gólt lő, stb. – de minek is mutatom be, elég ha visszaolvassátok, miket írtatok a tavaszi EC alatt és után Messiről!
      3.) Messi a válogatottban is óriásit tett le az asztalra, Gyakorlatilag egyedül kijuttatta az argentinokat a mesterhármasával.
      4.) És nem utolsó sorban az emberi oldalról. C egy jelenség, de sok olyan dolgot tesz, ami miatt minden stadionban kifütyülik. Messi egy ikon Barcelonaban, C-t még ti is sokszor ekézitek, sőt ha emlékezetem nem csal, a Bernabeuban a saját közönsége is fütyülte már ki. Hogy lehet valaki x-szeres aranylabdás, aki nem ünnepli a társai góljait!

      • Brn

        Messi ügyes fiú, de azért ismerd el, hogy az Ő aranylabdája egyikét Xavi vagy Iniesta simán megkaphatta volna. Szóval egyéniség ide, vagy oda, értelmetlen ez a díj úgy ahogy van. Bármit nyernek, vagy bármelyik mérkőzést elveszítik az a csapat érdeme/bukása. Az, hogy ki mennyire hasznos tagja a csapatnak, az már más kérdés. A múlt szezonban a Real mint csapat volt kiváló, a Barca-t mint idén Messi viszi a hátán 🙂

        • Matdroid

          Nyilván a spanyol VB győztes évben Iniestának kellett volna kapnia. De épp Xavi/Ini kiöregedése mutatta, hogy Messi képes vezéregyéniség lenni.
          De nem ez a lényeg. Nyilván Ronaldo idén is megérdemelte, me tavaly meg előtte …
          Egyszerűen az arány túlzó: 5-ből 4-szer nyerte, közben Messi miket tett le az asztalra!!!!!

          • dracox

            Azért volt egy 2010-es év is amikor Sneidjer-t várta mindenki aranylabdásnak…aztán megkapta az argentin…
            Valamint egy felcserélt év is volt CR és Messi között (ugyan azokat a díjakat zsebelték be egyik illetve másik évben) és mind a kétszer Messi kapta a lasztit.
            Ezt az 5-5 aranylabda szavazást én lezárnám kettejük között és jövőre jöhet egy újabb nyertes rajtuk kívül.

          • WT14

            Kár ezen vitatkozni. Van, akinek meggyőződése, hogy az elmúlt 10 évben legalább 8x Messinek kellett volna kapnia. Véleménye mindenkinek lehet, akár dühöngeni is lehet emiatt, vagy forgolódni éjszakánként, de a futballtörténelem nagykönyvébe az kerül bele ez évig, hogy mindketten ötszörös győztesek.

          • t20-puerto del sol

            11x!

          • t20-puerto del sol

            Csak ne Neymar.

      • carlos06

        1.Elhiszem, h duhos vagy.
        2. Ezt rosszul látod, CR brutális volt.
        3.Messi kijutatta a del amerikai csoportból Argentínat, ehhez gratulálok. CR is kijutott Portugáliaval.
        4. A maximalizmusa miatt van 5 aranylasztija, amiert kidolgozta a belét, sajnos emiatt az energia miatt néha olyan a pályán amilyen. A pályán kívül példaértékű a kamerának és a sajtónak mutatott viselkedése is. Összessegeben a mai elszallt fiataloknak a munkamoralja es a palyan kivuli viselkedése is példaerteku. Nem mindenki születik Messinek, nekik CR útját kell követni.

    • Brn

      Ez a Ronaldo meg Messi állandó egymáshoz hasonlításának az eredménye. Két teljesen különböző, korunk nagy zsenijéről van szó, csak Ronaldo legalább tízszer többet tett és tesz azért, hogy jobb legyen Messinél. Gyerek kora óta küzd, edz, hajt, akar, fejlődik, robotol. Korábbi gyerekkori edzője mesélte, hogy Ronaldo edzés után egy olyan emelkedő útelágazásnál tesztelte kitartását, erejét, gyorsaságát, ahol egy fényjelző irányította a forgalmat, és amikor éppen egy autó a piros jelzésre megállt, vártak a zöld jelzésre, majd együtt indulva az autóval, próbálta lekerülni. Szóval nem mindennapi kitartásról tanúskodik. Ehelyett Messi pedig egy Istenadta tehetség, teremtéskor az Úr eszméletlen adottságokkal áldotta meg amit remekül ki is használ, biztos vagyok benne, hogy felét nem tette meg, mint Ronaldo. Ronaldo a munka, a kitartás példaképe, Messi meg egy született zseni, ki ki döntse el melyik szimpatikusabb számára, de értelmetlen őket egymáshoz hasonlítani.
      Egyszer Mario Götze nyilatkozta, hogy szeretne olyan lenni mint Ronaldo, mert olyannak lenni mint Messi, lehetetlen.

      • Cornelius Scipio Africanus

        Szerintem ez is erős csúsztatás. Jah mert a zsenik ültek a fotelben aztán feltalálták a dolgokat. Messi se edzett, csak dekázgatott. Értem mit írsz, de szerintem csak féligazság. Egyetlen egy zseni se ér el semmit, ha nem küzd meg érte. Az lehet hogy valaki kevésbé tehetséges, és többet kell küzdenie, van aki meg tehetségesebb és elég kevesebbet tenni egy célért. De itt lassan úgy van beállítva a dolog, mintha Cr egy átlagos focista lenne és csak a szorgalma miatt lett ilyen játékost, míg Messitől meg elveszi, hogy ő valaha is küzdött volna. Eszméletlen nagy csúsztatás.

        • Brn

          Ez egy vélemény, amelyben nincs szó “csúsztatásról”, de én nem azt mondtam, hogy Messi semmit sem tett azért aki, hanem azt, hogy Messi-t Isten jobban megáldotta tehetséggel mint Ronaldo-t, Ronaldo többet dolgozott szemben Messivel, akit én tehetségesebbnek tartok. A tehetség önmagában mit sem ér, ha nem párosul mellé szorgalom.

      • helybeli

        Többször leírtad, hogy Messi a felét sem tette meg, mint Ronaldo. Gondolom, ez csak az érveid erősítése miatti jókora túlzás.
        Nem vitás, hogy CR szorgalmas, emiatt lehetne példaképnek állítania fiatalok elé. Csak arra kell vigyázni, hogy azok a képek nehogy a mai fiatalok elé kerüljenek, amelyek a mérhetetlen egóját mutatják be. A dühöngéseit. A színészkedéseit. Az “én vagyok a valaha volt legjobb” típusú megnyilvánulásait. Összességében – annyira nem szeretném, ha ő lenne a mai fiatalok példaképe.
        Egyébként kicsit furcsa az érvelésed. Ne a legjobb hangú énekes nyerjen az énekversenyen, neki könnyű, úgy született. Nyerjen az, aki a legtöbbet gyakorolta az éneklést, igaz, hamisabb egy kicsit a másiknál.
        Az idei év pontosan megmutatja, mitől jó Ronaldo. A csapattól. Ha a csapat jó, akkor Ronaldo gólokat lő. Ha a csapatnak nem nagyon megy, Ronaldo nem nagyon lő gólokat. S tudjuk, hogy Messinél ez kb. tökmindegy. Egymaga, a csapattól függetlenül képes gólt lőni. Nála egy félpályán megkapott labda, előtte 4-5 védővel, gyakorlatilag gólhelyzet.
        Peace.

        • Jose

          Juventus-Barcelona 3-0
          Barcelona-Juventus 0-0
          BL-negyeddöntő, 2016/17.
          Peace.

          • Sragi

            * VB selejtező az utolsó meccsig kb.

          • t20-puerto del sol

            Jó, de akkor tuti nem kapott Messi labdát a felezőn.

          • Jose

            Ja, csakis az lehet a magyarázat. Így már értem. 🙂 Köszönöm! 😀

        • Cornelius Scipio Africanus

          “Nála egy félpályán megkapott labda, előtte 4-5 védővel, gyakorlatilag gólhelyzet.”
          Az ilyen kijelentések semmivel sem különbek annál mint hogy “én vagyok a valaha volt legjobb” .
          Ugye ezt érzed?

          • Jose

            Ott a pont. 🙂

          • helybeli

            Igazad lehetne, de tucatnyi ilyen videót tudnék linkelni.
            És ugyebár én, egy fan mondom ezt, nem Messi saját magáról. Mekkora különbség.

          • Cornelius Scipio Africanus

            Nézd, őszinte leszek. Leírom megint. Én Real Madrid szurkoló vagyok. Leszarom az egész CR Messi vitát. Idejöttök és erősködtök, mert frusztráltak vagytok az eredmény miatt. Pedig nem kéne. Tök mindegy hogy melyik a jobb. Legalábbis szerintem. A Realban volt és még lesz is akkora játékos mint Ronaldo. Gyanítom ez a helyzet a Barcában is. Nekem hiába írod, és próbálsz meggyőzni, nem tudsz, mert nincs miben. Engem őszintén hidegen hagy ez az egész baromság. Én tisztelem Messit is, egy k*rva rossz szót nem írtam rá – (vagy talán dühből,de nem is emlékszem rá, és ha így is volt sajnálom). De az amit némelyikőtök csinál azzal hogy Istent farag bármelyikből is, az számomra taszító. És nincs különbség aközött, hogy ezt ki mondja, csinálja. Hála égnek itt a Merenguésen nincs CR imádat. Bele is őrülnék, nem is járnék ide. Sőt inkább szerintem több kritika hangzik el sokkal, mint CR imádat. És őszintén mondom, a faszom kivan azzal, hogy 0 kommentet akartam erre az egész kurva aranylabdára szánni, meg az egész két gépállat összehasonlítására (sőt, szerintem lehetetlen küldetés) de tegnap úgy jöttél ide hogy :
            “Szabad szólni? 🙂
            Szerintetek Cristiano Ronaldo a Real Madrid legjobb játékosa?

            (ha az oldal adminjai a kérdésem támadásnak értékelik, azonnal törlöm, és elnézést kérek)”

            Ehelyett ezen “pörög” a komment, mikor rég túl lenne már ezen a “közösség”. De miért nincs? Mert jön mindig valaki hogy de Messi így, bezzeg a gonosz geci CR. Nekem ez kurvára dedós. Kurvára unom. És bármit írok, normálisan, akkor is jön valami kibaszott sértődött komment 😀 Hihetetlen. Úgyhogy le is lépek pár napra, mert ez nem értelmes beszélgetés. Mégis mi a faszt vártok el? Hogy istenítsük Messit és köpködje mindenki CR-t? Vagy mit? 😀 Nekem ebből rohadtul elegem van. Bárki bármit ír, nektek semmi nem jó. Éltek a kis világotokba és bárki próbál elgondolkoztatni, akkor jön a sértődés, meg a reakció reakciójának a reakciója, meg a videólinkelgetés, stb. Megmondom őszintén: nem érdekel! Se CR, se Messi. A faszom, ez FOCI, nem két játékosról szól.

          • Sragi

            Engedd el :)) Én már nagyon rég megtettem.

          • nad

            Ápvót, full értelmetlen az egész vita.

            Viszont a komment azon részéhez hogy a barcaban volt és lesz is nála nagyobb játékos, ez nem igy van, akármennyire is azt mondja az ember hogy első a klub és utána a játékosok, ez most nálunk nem igy van. Annyit mondott volna hogy a jelenlegi elnokseggel nem akar együtt dolgozni komolyan a főtéren végezték volna ki őket. Ezt mindenki eldontheti hogy zavarja-e.

            Messi a klub történetének magasan legjobb és legfontosabb játékosa, ha nem csak játékos pályafutást nézünk akkor is max Cruyff van vele egy szinten, de egyszerűen annyira meseszerű az egész hogy még ő sem.

            (ui az egész aranylabdat távolról sem Cr első helye teszi viccessé hanem Kroos17. Helye)

          • Sragi

            Utolsó mondatod a zárójelben mutatja meg a dolog létjogosultságát 🙂

          • helybeli

            Biztos az lenne a legjobb, ha nem válaszolnék, mert így valószínűleg csak továbbra fenntartom a már eddig is sajnálatos feszült indulatot.
            Én tisztelem ezt az oldalt, az ide írókat is. Pont azért, mert korrektek. Eszméletlen jó elemzéseket olvasok itt, főleg emiatt járok ide. És belelátok a problémáitokba, így is többet tudok meg saját csapatom esélyeiről.
            Rengeteg válaszom lenne arra, amit írtál, de nem fogom leírni. Valamiért te meg én nem tudunk úgy beszélni, hogy ne jöjjenek elő indulatok.

            Azért remélem, igazából nem (csak) nekem szól ez, hanem a dühöd jött csak ki, és én kaptam. Ugyanis én egy korábbi kommentre válaszoltam. Mintha nemcsak én pörögtem volna rá itt.

            Valahol sajnálom, hogy a legtöbb párbeszéd tényleg átcsap sértődésbe, kurvára unásba, kibaszott sértődésbe, faszt elvárásba, köpködésbe, meg faszom fociba. Megint egyetértünk: ez így értelmetlen vita.

          • Gareth

            Alapvetoen nem ertem, miert nem a barca forumon irkal, akinek az a kedvenc csapata… hagyjuk a eszmecsere bullshitet.

        • carlos06

          “S tudjuk, hogy Messinél ez kb. tökmindegy. Egymaga, a csapattól függetlenül képes gólt lőni. Nála egy félpályán megkapott labda, előtte 4-5 védővel, gyakorlatilag gólhelyzet.”

          Nem tudom kik vagytok, de szerintem ezt meg a Barcasok sem tudják.
          Nem is értem miért játszák le a meccseket.

          Fura dolog amúgy, h rengeteg szurkoló piszkálja CR mikroszkóppal figyelt viselkedését a pályán, de ha nagy átlagban vegigmennek a fórumokon, akkor ezek a szurkolók 10-szer butabban viselkednek és ez csak a felszín.
          Nekem szimpatikusabb és fontosabb egy munkamanias egomán jótékonykodó történelmet író sportoló, mint az a minimális negatívum nála, ami leginkább arra jó, h a frusztrációjukat kiéljék rajta a képmutató fotelszurkolok. Mondjuk ebből látszik, h jól végzi a dolgát.

        • Sasu

          Kicsit keverednek azok a meccsek, ahol a Barca 75%ban birtokolja a labdát, és öt góllal nyer, meg a valóban fontos, kiélezett meccsek. A nehéz mecseken Messi már korántsem villog az elmúlt években, voltak itt Libertadores döntők is, BL meccsek, ahol nem tudott semmit csinálni. Vannak persze ezeken is szép góljai, megmozdulásai, de arányában nem több, mint Ronaldonak.

        • sultan2004

          Jó-jó, én elolvastam a Messi könyvet, amiben ott van, hogy növekedési hormon kezelést kapott, mert attól féltek, hogy sose nő meg. Az izomfejlődését a gyorsaságát alapvetően befolyásolhatta a dolog. De a tehetsége vitathatatlan. És a csapathoz, a futballhoz való hozzááálása is egész más (sokkal emberibb) , mint Ronaldóé. De a szorgalom, kontra tehetség vitában a legszörnyűbb, az, hogy Ronaldo öregedve drasztikusan fogja elveszíteni gyorsaságát, és vele a legfontosabb skilljeit, míg Messi 40 évesen is el fog fektetni bárkit két testcsellel.

          • helybeli

            Figyelj, közben megértettem, hogy miért nem voltam teljesen frankó.
            Beállítok ide, és azt vártam, hogy pont ti kezdjétek igazolni, hogy CR alaptalanul kapta az aranylabdát. Egymás közt, egymásnak mondjátok – de egy Barcásnak? Én szidhatom a gyerekemet, ha más tenné, lecsavarom a fejét. Mintha becsöngetnék a szomszédba és azt kérném tőle, hogy ismerje el: az én fiam jobban megérdemelte volna az iskolai farsang fődíját.
            Az Aranylabda kapja be, az én fiam érdemelte volna a tortát, és nem foglak arra kérni benneteket, hogy blamáljátok előttem a saját fiatok jelmezét, amit 3 napig varrt az asszony.

          • MrPaul

            Simán eltudom képzelni Messit 37 évesen Pirlo helyén csoszogni és osztogatni a nagyobbnál nagyobb labdákat 😀

  • Jose
    • Cornelius Scipio Africanus

      Újra BBC? <3

  • kodex

    mikor lesz kint Sevilla beharang? (és ki írja?)

    • mfc777

      ReAlantos

    • ReAlantos

      Már csak napok kérdése!

  • Sragi

    Engedjük el ezt az aranyszardarab témát 🙂

  • ReAlantos

    Se kanál, se kés, … Na, szóval beharang. Sipirc!

    https://madridimerengues.hu/2017/12/08/vissza-a-szurke-hetkoznapokhoz/